20% OFF shipping at ultimatravel.net on orders over $79 + up to 10% OFF products
ultimatravel.net
home > CD15 Recombinant Protein - NCP0178 > CD15 Recombinant Protein - NCP0178
download picture
CD15 Recombinant Protein - NCP0178CD15 Recombinant Protein Catalogue Number: NCP0178 500, NCP0178 1000 Sizes: 500ug, 1mg Swiss Prot: P22083 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD15 Recombinant Protein

Catalogue Number: NCP0178-500, NCP0178-1000

Sizes: 500ug, 1mg

Swiss-Prot: P22083

Host: E.coli

Tag: His-tag

AA Sequence: GGTCAGCTGCCGCCTCTGCCTTGGGCCAGCCCTACCCCTAGCCGCCCTGTTGGTGTTCTGCTGTGGTGGGAACCGTTCGGCGGCCGTGATAGTGCCCCGCGTCCGCCTCCTGATTGCCGCTTACGCTTCAATATTAGCGGTTGCCGCCTGCTGACCGATCGTGCAAGTTATGGCGAAGCACAGGCAGTGCTGTTCCATCATCGCGATCTGGTGAAAGGTCCGCCGGATTGGCCGCCGCCGTGGGGTATTCAGGCACATACCGCCGAAGAAGTTGATCTGCGCGTTCTGGATTATGAAGAAGCCGCCGCCGCAGCCGAAGCACTGGCTACAAGTAGTCCGCGTCCGCCGGGTCAGCGCTGGGTGTGGATGAACTTCGAAAGCCCGAGCCATAGCCCGGGTCTGCGCAGTCTGGCAAGCAATCTGTTCAATTGGACCCTGAGCTATCGTGCAGATAGCGATGTGTTCGTTCCGTATGGCTATCTGTATCCGCGTAGCCATCCGGGCGATCCGCCGTCAGGTCTGGCACCTCCGCTGAGCCGCAAACAGGGCCTGGTTGCCTGGGTTGTGAGCCATTGGGATGAACGTCAGGCCCGTGTGCGCTATTATCATCAGCTGAGTCAGCATGTGACCGTGGATGTGTTCGGTCGTGGCGGTCCGGGTCAGCCGGTGCCTGAAATTGGCCTGCTGCATACCGTGGCACGTTATAAATTCTATCTGGCCTTCGAAAATAGTCAGCATCTGGATTATATTACCGAAAAACTGTGGCGCAATGCACTGCTGGCCGGTGCCGTTCCGGTGGTTCTGGGTCCGGATCGTGCCAATTATGAACGCTTCGTTCCGCGCGGCGCATTCATTCATGTTGATGACTTCCCGAGTGCAAGCAGTCTGGCAAGTTATCTGCTGTTCCTGGATCGTAATCCGGCAGTGTATCGCCGTTACTTCCATTGGCGCCGTAGCTATGCCGTGCATATTACCAGCTTCTGGGATGAACCGTGGTGCCGCGTGTGTCAGGCAGTTCAGCGTGCAGGCGATCGCCCGAAAAGCATTCGCAATCTGGCAAGCTGGTTCGAACGT

Restriction Sites: NdeI-XhoI

Background: SSEA-1 antibody detects a lactoseries oligosaccharide antigen that is expressed on the surface of mouse embryonal carcinoma and embryonic stem cells. This antigen is also found on early mouse embryos and both mouse and human germ cells, but is absent on human embryonic stem cells and human embryonic carcinoma cells. Expression of SSEA1 in these human cell types increases upon differentiation, while on the mouse cell types differentiation leads to decreased expression.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~44kDa

Notes: For research use only, not for use in diagnostic procedure.

CD15 Recombinant Protein - NCP0178

Item no : 16515364818
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches