CD162 Recombinant Protein

Catalogue Number: NCP0286-500, NCP0286-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q14242

Host: E.coli

Tag: His-tag

AA Sequence: CAGGCAACCGAATATGAATATCTGGATTATGACTTCCTGCCGGAAACCGAACCGCCGGAAATGCTGCGCAATAGTACCGATACCACCCCGCTGACCGGTCCGGGTACCCCTGAAAGCACCACCGTGGAACCGGCAGCACGTCGCAGTACCGGTCTGGATGCAGGTGGCGCAGTTACCGAACTGACCACCGAACTGGCCAATATGGGTAATCTGAGCACCGATAGTGCAGCCATGGAAATTCAGACCACCCAGCCGGCAGCAACCGAAGCACAGACCACCCAACCGGTTCCGACCGAAGCACAAACCACCCCGTTAGCCGCAACCGAAGCGCAGACCACCCGCCTGACCGCAACCGAAGCCCAGACCACCCCGCTTGCAGCAACCGAGGCACAGACCACACCGCCGGCAGCCACCGAAGCCCAAACCACCCAGCCTACCGGCCTGGAAGCACAGACAACCGCCCCGGCAGCCATGGAGGCACAGACAACAGCACCGGCAGCCATGGAAGCACAGACGACCCCGCCGGCAGCAATGGAAGCCCAGACAACCCAGACCACCGCCATGGAAGCGCAGACAACCGCACCGGAAGCAACCGAAGCTCAGACCACCCAGCCAACCGCAACCGAGGCCCAGACCACACCTCTGGCCGCCATGGAAGCTCTGAGCACCGAACCGAGCGCCACCGAAGCGCTGAGCATGGAACCGACCACCAAACGTGGTCTGTTCATTCCGTTCAGCGTTAGCAGTGTGACCCATAAAGGCATTCCGATGGCAGCCAGCAATCTGAGCGTTAATTATCCGGTGGGCGCACCGGATCATATTAGTGTTAAACAGTGT

Restriction Sites: NdeI-XhoI

Background: PSGL-1 (P-Selectin glycoprotein ligand, also designated CD162), exists as a disulfide-linked homodimer. PSGL-1 is a type 1 membrane protein that localizes on the tips of microvilli of leukocytes. Its extracellular domain is rich in serines, threonines and prolines, and includes a series of 15 and 16 ecameric repeats in HL-60 and U-937 cells, and human leukocytes, respectively. Although PSGL-1 appears to be the sole receptor for P-Selectin on human hematopoietic cells, it also interacts with E-Selectin through a unique binding site. In order to bind PSGL-1 to either E-Selectin or P-Selectin, PSGL-1 must be sialylated and fucosylated. PSLG-1 is a mucin-like molecule, much like leukosialin (CD43), CD164 and CD34. These proteins belong to an emerging family of cell adhesion receptors called sialomucins, which transduce negative signals in hematopoietic cells.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~53kDa

Notes: For research use only, not for use in diagnostic procedure.