20% OFF shipping at ultimatravel.net on orders over $79 + up to 10% OFF products
ultimatravel.net
home > CD48 Recombinant Protein - NCP0213 > CD48 Recombinant Protein - NCP0213
download picture
CD48 Recombinant Protein - NCP0213CD48 Recombinant Protein Catalogue Number: NCP0213 500, NCP0213 1000 Sizes: 500ug, 1mg Swiss Prot: P09326 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD48 Recombinant Protein

Catalogue Number: NCP0213-500, NCP0213-1000

Sizes: 500ug, 1mg

Swiss-Prot: P09326

Host: E.coli

Tag: His-tag

AA Sequence: CAGGGTCATCTGGTTCACATGACCGTTGTGAGCGGTAGCAATGTTACCCTGAATATTAGCGAAAGCCTGCCGGAAAATTATAAACAGCTGACCTGGTTCTATACCTTCGATCAGAAAATTGTGGAATGGGATAGTCGTAAAAGTAAATACTTCGAAAGCAAATTCAAGGGCCGTGTGCGTCTGGATCCGCAGAGCGGCGCCCTGTATATTAGCAAAGTTCAGAAAGAAGATAACAGTACCTATATTATGCGCGTGCTGAAAAAAACCGGTAATGAACAGGAATGGAAAATTAAACTGCAGGTGCTGGATCCGGTGCCGAAACCGGTTATTAAAATTGAAAAAATCGAGGATATGGACGATAATTGTTATCTGAAACTGAGTTGCGTGATTCCGGGTGAAAGCGTTAATTATACCTGGTATGGCGATAAACGTCCGTTCCCGAAAGAACTGCAGAATAGCGTTCTGGAAACCACCCTGATGCCGCATAATTATAGTCGCTGTTATACCTGTCAGGTTAGTAATAGTGTTAGCAGCAAAAATGGTACCGTGTGTCTGAGTCCGCCGTGTACCCTGGCACGTAGT

Restriction Sites: NdeI-XhoI

Background: CD48 is a glycosylphosphatidylinositol (GPI) -anchored membrane protein of the signaling lymphocyte activation molecule (SLAM) family, also known as SLAMF2 and BLAST-1. It is constitutively expressed on most hematopoietic cells (not on neutrophils and a subset of long-term hematopoietic stem cells in mice) and can be upregulated under certain conditions like infection. Interaction with its low affinity ligand CD2 promotes adhesion and TCR signaling. Interaction with the high affinity ligand CD244 (2B4) regulates natural killer (NK) and CD8 T cell activation and cytolytic function.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~21kDa

Notes: For research use only, not for use in diagnostic procedure.

CD48 Recombinant Protein - NCP0213

Item no : 89354502629
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches