IL-1Ra/CD121a Recombinant Protein

Catalogue Number: NCP0239-500, NCP0239-1000

Sizes: 500ug, 1mg

Swiss-Prot: P14778

Host: E.coli

Tag: His-tag

AA Sequence: CTGGAAGCAGATAAATGCAAAGAACGTGAAGAAAAAATCATCCTGGTTAGTAGCGCCAATGAAATTGATGTGCGTCCGTGTCCGCTGAATCCGAATGAACATAAAGGTACCATTACCTGGTATAAAGATGATAGTAAAACACCTGTGAGCACCGAACAGGCCAGTCGTATTCATCAGCATAAAGAAAAACTGTGGTTCGTTCCGGCCAAAGTTGAAGATAGTGGCCATTATTATTGTGTGGTGCGCAATAGCAGTTATTGTCTGCGTATTAAAATCAGTGCAAAATTCGTTGAAAACGAACCGAATCTGTGCTATAATGCACAGGCAATCTTCAAACAGAAACTGCCGGTGGCCGGTGATGGTGGTCTGGTGTGCCCGTATATGGAATTCTTCAAAAATGAAAACAACGAGCTGCCGAAACTGCAGTGGTATAAAGACTGCAAACCGCTGCTGCTGGATAATATTCACTTCAGTGGTGTGAAAGATCGTCTGATTGTTATGAATGTGGCAGAAAAACATCGTGGTAATTATACCTGTCATGCAAGCTATACCTATCTGGGCAAACAGTATCCGATTACCCGCGTTATTGAATTCATTACCCTGGAAGAAAATAAGCCGACCCGTCCGGTGATTGTTAGTCCGGCCAATGAAACCATGGAAGTGGATCTGGGTAGTCAGATTCAGCTGATCTGTAATGTTACCGGCCAGCTGAGCGATATTGCATATTGGAAATGGAATGGTAGTGTTATTGATGAAGATGATCCGGTTCTGGGTGAAGATTATTATAGTGTGGAAAATCCGGCAAATAAACGCCGCAGTACCCTGATTACCGTTCTGAATATTAGCGAAATTGAAAGCCGCTTCTATAAACATCCGTTCACCTGCTTCGCAAAAAATACCCATGGTATTGATGCAGCATATATTCAGCTGATCTATCCGGTGACCAACTTCCAGAAA

Restriction Sites: NdeI-XhoI

Background: Three structurally related ligands for IL-1Rs have been described. Theseinclude two agonists, IL-1α and IL-1β, and a specific receptor antagonist, IL-1Rα. Among the activities regulated by IL-1 are fever, acute phase responses, degradation of connective tissue and immunostimulatory activities. The IL-1Rα molecule also binds specifically to IL-1Rs, but fails to initiate intracellular responses. Two distinct IL-1Rs have been identified, each of which belongs to the Ig superfamily and is widely expressed in a broad range of cells and tissues. Although many cell types co-express type I and type II receptors, there is no evidence that these constitute subunits of a single complex. The type II receptor has a short 29 amino acid cytoplasmic domain that does not seem sufficient for signaling while in fact there is considerable evidence arguing that IL-1 signals exclusively through the type I IL-1R.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~40kDa

Notes: For research use only, not for use in diagnostic procedure.