CD244 Recombinant Protein

Catalogue Number: NCP0193-500, NCP0193-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q9BZW8

Host: E.coli

Tag: His-tag

AA Sequence: TGCCAGGGTAGCGCCGATCATGTGGTGAGTATTAGTGGTGTGCCGCTGCAGCTGCAGCCGAATAGCATTCAGACCAAAGTTGATAGTATTGCATGGAAAAAACTGCTGCCGAGCCAGAATGGCTTCCATCATATTCTGAAATGGGAAAATGGTAGCCTGCCGAGTAATACCAGTAATGATCGCTTCAGCTTCATTGTTAAAAATCTGAGTCTGCTGATTAAGGCCGCCCAGCAGCAGGATAGTGGCCTGTATTGCCTGGAAGTTACCAGTATTAGCGGTAAAGTTCAGACCGCAACCTTCCAGGTGTTCGTGTTCGAAAGCCTGCTGCCGGATAAAGTGGAAAAACCGCGCCTGCAGGGCCAGGGTAAAATTCTGGATCGTGGCCGTTGCCAGGTGGCCCTGAGTTGCCTGGTTAGCCGTGATGGCAATGTTAGTTATGCATGGTATCGCGGTAGCAAACTGATTCAGACCGCAGGCAATCTGACCTATCTGGATGAAGAAGTTGATATTAATGGCACCCATACCTATACCTGCAATGTGAGTAATCCGGTGAGTTGGGAAAGTCATACCCTGAATCTGACCCAGGATTGTCAGAATGCACATCAGGAATTCCGCTTCTGGCCG

Restriction Sites: NdeI-XhoI

Background: 2B4, also known as signaling lymphocytic activation molecule family member 4 (SLAMF4) and cluster of differentiation 244 (CD244), is a heterophilic cell surface receptor expressed on a variety of immune cells, including natural killer (NK) cells, T cells, eosinophils, mast cells, and dendritic cells. 2B4 has been shown to have both immune stimulatory and inhibitory effects on cells. Upon engagement of its ligand CD48, 2B4 can enhance immune cell signaling, cytokine production, non-major histocompatibility complex-restricted cytotoxicity, and cell migration. Conversely, at early stages of NK cell differentiation, 2B4 may function as an inhibitory receptor possibly ensuring the self-tolerance of developing NK cells. 2B4 also inhibits inflammatory responses in dendritic cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~25kDa

Notes: For research use only, not for use in diagnostic procedure.