20% OFF shipping at ultimatravel.net on orders over $79 + up to 10% OFF products
ultimatravel.net
home > CD244 Recombinant Protein - NCP0193 > CD244 Recombinant Protein - NCP0193
download picture
CD244 Recombinant Protein - NCP0193CD244 Recombinant Protein Catalogue Number: NCP0193 500, NCP0193 1000 Sizes: 500ug, 1mg Swiss Prot: Q9BZW8 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD244 Recombinant Protein

Catalogue Number: NCP0193-500, NCP0193-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q9BZW8

Host: E.coli

Tag: His-tag

AA Sequence: TGCCAGGGTAGCGCCGATCATGTGGTGAGTATTAGTGGTGTGCCGCTGCAGCTGCAGCCGAATAGCATTCAGACCAAAGTTGATAGTATTGCATGGAAAAAACTGCTGCCGAGCCAGAATGGCTTCCATCATATTCTGAAATGGGAAAATGGTAGCCTGCCGAGTAATACCAGTAATGATCGCTTCAGCTTCATTGTTAAAAATCTGAGTCTGCTGATTAAGGCCGCCCAGCAGCAGGATAGTGGCCTGTATTGCCTGGAAGTTACCAGTATTAGCGGTAAAGTTCAGACCGCAACCTTCCAGGTGTTCGTGTTCGAAAGCCTGCTGCCGGATAAAGTGGAAAAACCGCGCCTGCAGGGCCAGGGTAAAATTCTGGATCGTGGCCGTTGCCAGGTGGCCCTGAGTTGCCTGGTTAGCCGTGATGGCAATGTTAGTTATGCATGGTATCGCGGTAGCAAACTGATTCAGACCGCAGGCAATCTGACCTATCTGGATGAAGAAGTTGATATTAATGGCACCCATACCTATACCTGCAATGTGAGTAATCCGGTGAGTTGGGAAAGTCATACCCTGAATCTGACCCAGGATTGTCAGAATGCACATCAGGAATTCCGCTTCTGGCCG

Restriction Sites: NdeI-XhoI

Background: 2B4, also known as signaling lymphocytic activation molecule family member 4 (SLAMF4) and cluster of differentiation 244 (CD244), is a heterophilic cell surface receptor expressed on a variety of immune cells, including natural killer (NK) cells, T cells, eosinophils, mast cells, and dendritic cells. 2B4 has been shown to have both immune stimulatory and inhibitory effects on cells. Upon engagement of its ligand CD48, 2B4 can enhance immune cell signaling, cytokine production, non-major histocompatibility complex-restricted cytotoxicity, and cell migration. Conversely, at early stages of NK cell differentiation, 2B4 may function as an inhibitory receptor possibly ensuring the self-tolerance of developing NK cells. 2B4 also inhibits inflammatory responses in dendritic cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~25kDa

Notes: For research use only, not for use in diagnostic procedure.

CD244 Recombinant Protein - NCP0193

Item no : 21381838012
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches